geoscience.net logo
+ Resolve Article
+ Follow Us
Follow on FacebookFollow on Facebook
Follow on TwitterFollow on Twitter

+ Translate
+ Subscribe to Site Feed
GeoScience Most Shared ContentMost Shared Content

Open reading frame 50 protein of Kaposi's sarcoma-associated herpesvirus directly activates the viral PAN and K12 genes by binding to related response elements


, : Open reading frame 50 protein of Kaposi's sarcoma-associated herpesvirus directly activates the viral PAN and K12 genes by binding to related response elements. Journal of Virology 76(7): 3168-3178

Open reading frame (ORF) 50 protein is capable of activating the entire lytic cycle of Kaposi's sarcoma-associated herpesvirus (KSHV), but its mechanism of action is not well characterized. Here we demonstrate that ORF 50 protein activates two KSHV lytic cycle genes, PAN (polyadenylated nuclear RNA) and K12, by binding to closely related response elements located approximately 60 to 100 nucleotides (nt) upstream of the start of transcription of the two genes. The 25-nt sequence 5' AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cells and B cells in the absence of other KSHV proteins. The responsive region of DNA can be transferred to a heterologous minimal promoter. Extensive point mutagenesis showed that a span of at least 20 nt is essential for a response to ORF 50 protein. However, a minimum of six positions within this region were ambiguous. The related 26-nt responsive element in the K12 promoter (K12p), 5' GGAAATGGGTGGCTAACCCCTACATA, shares 20 nt (underlined) with the comparable region of PANp. The divergence is primarily at the 3' end. The DNA binding domain of ORF 50 protein, encompassing amino acids 1 to 490, fused to a heterologous activation domain from herpes simplex virus VP16 (ORF 50(1-490) + VP) can mediate activation of reporter constructs bearing these response elements. Most importantly, ORF 50(1-490) + VP can induce PAN RNA and K12 transcripts in transfected cells. ORF 50(1-490) + VP expressed in human cells binds specifically to duplex oligonucleotides containing the responsive regions from PANp and K12p. These DNA-protein complexes were supershifted by antibody to VP16. ORF 50(1-490) without a VP16 tag also bound to the response element. There was a strong correlation between DNA binding by ORF 50 and transcriptional activation. Mutations within PANp and K12p that impaired transactivation by ORF 50 or ORF 50(1-490) + VP also abolished DNA binding. Only one of eight related complexes formed on PANp and K12p oligonucleotides was due to ORF 50(1-490) + VP. The other complexes were due to cellular proteins. Two KSHV lytic-cycle promoters are activated by a similar mechanism that involves direct recognition of a homologous response element by the DNA binding domain of ORF 50 protein in the context of related cellular proteins.

US$19.90

PMID: 11884541

DOI: 10.1128/jvi.76.7.3168-3178.2002


Other references

Barousse, P.; Saper, M.; Meijer, K.; Roth, C.; Andrews, J.R., 2016: Valgus Extension Overload: Arthroscopic Decompression in the Supine-Suspended Position. NlmCategory="UNASSIGNED">Elbow arthroscopy is a useful tool for managing diseases of the elbow, including valgus extension overload, when conservative treatments have failed. Arthroscopic access to the elbow in the supine-suspended po...

Bernet, T., 1998: Past and present development of the Peruvian dairy sector: a base document for further research. In recent years, Peru has experienced a strong growth in the demand for milk products. Domestic milk production increased in the main milk-sheds even though the Peruvian dairy market has been exposed to increasing international competition by impo...

Murray, G.J.; Howard, K.D.; Richards, S.M.; Barton, N.W.; Brady, R.O., 1991: Gaucher's disease lack of antibody response in 12 patients following repeated intravenous infusions of mannose terminal glucocerebrosidase. An amplified ELISA has been employed for monitoring the safety of repeated intravenous infusions of modified human placental glucocerebrosidase. The enzyme infusions consisted of biweekly injections of macrophage targeted glucocerebrosidase over a...

Koyasu, S.; Moro, K., 2012: Role of innate lymphocytes in infection and inflammation. Cooperation between the innate and adaptive immune responses is critical for enabling protective immunity against various invading microbes. Distinct types of effector T cells have different functions in adaptive immune responses. Th1 cells play i...

Araco, F.; Gravante, G.; Sorge, R.; Overton, J.; D.V.ta, D.; Primicerio, M.; Dati, S.; Araco, P.; Piccione, E., 2009: The influence of BMI, smoking, and age on vaginal erosions after synthetic mesh repair of pelvic organ prolapses. A multicenter study. To study the influence of body mass index (BMI), smoking, and age on the risk of vaginal erosions after mesh repair of pelvic prolapses. Retrospective study. Three university and community hospitals. Patients that underwent mesh correction of prol...

Mousa, J.J.; Sauer, M.F.; Sevy, A.M.; Finn, J.A.; Bates, J.T.; Alvarado, G.; King, H.G.; Loerinc, L.B.; Fong, R.H.; Doranz, B.J.; Correia, B.E.; Kalyuzhniy, O.; Wen, X.; Jardetzky, T.S.; Schief, W.R.; Ohi, M.D.; Meiler, J.; Crowe, J.E., 2016: Structural basis for nonneutralizing antibody competition at antigenic site II of the respiratory syncytial virus fusion protein. NlmCategory="UNASSIGNED">Palivizumab was the first antiviral monoclonal antibody (mAb) approved for therapeutic use in humans, and remains a prophylactic treatment for infants at risk for severe disease because of respiratory syncytia...

Portis Sidney A. (Edited By), 1953: Diseases of the digestive system. For the 3d edition of this well accepted text on diseases of the digestive tract, most of the chapters have been revised and many new ones added in order to keep stride with the last 6 years' advances in the management of gastrointestinal dys...

Petelis, K.; Brazaitis, G., 2003: Morphometric data on the field ecotype roe deer in Southwest Lithuania. The formation process of the field ecotype of roe deer began in woodless (woods cover only 9% of the territory) flatlands of Southwest Lithuania with rich soil during 1965-1967. The field ecotype roe deer was heavier than the forest ecotype: the a...

Chan, J.R.; Rodriguez-Waitkus, P.M.; Ng, B.K.; Liang, P.; Glaser, M., 2000: Progesterone synthesized by Schwann cells during myelin formation regulates neuronal gene expression. Previously, progesterone was found to regulate the initiation and biosynthetic rate of myelin synthesis in Schwann cell/neuronal cocultures. The mRNA for cytochrome P450scc (converts cholesterol to pregnenolone), 3beta-hydroxysteroid dehydrogenase...

D.S.nctis, R.; Bertuzzi, A.; Basso, U.; Comandone, A.; Marchetti, S.; Marrari, A.; Colombo, P.; Lutman, R.Fabio.; Giordano, L.; Santoro, A., 2015: Non-pegylated liposomal doxorubicin plus ifosfamide in metastatic soft tissue sarcoma: results from a phase-II trial. Non-pegylated liposomal doxorubicin (NPLD) has demonstrated antitumour activity equivalent to conventional doxorubicin and a significantly lower risk of cardiotoxicity. This phase II trial was performed to evaluate the activity and the safety of N...