geoscience.net logo
+ Resolve Article
+ Follow Us
Follow on FacebookFollow on Facebook
Follow on TwitterFollow on Twitter

+ Translate
+ Subscribe to Site Feed
GeoScience Most Shared ContentMost Shared Content

Plastic film in foreign plant shipments


, : Plastic film in foreign plant shipments. Amer. Nurserym, 96: 18-20, 124-9. bibl. 5

Among the plant material wrapped in plastic film, usually polythene, which successfully survived long distance transport to and from the U.S. were temperate zone, subtropical and tropical fruit trees and their bud wood, strawberry, raspberry and mint plants, vine and sugar cane cuttings, bamboo rhizomes and mango seeds.

US$29.90


Other references

Braun, J.-J., 2010: Riniti professionali. (RP) rappresentano un reale problema medico e socioeconomico legato all ambiente professionale. Malgrado la loro frequenza elevata nel quadro delle malattie respiratorie professionali, le RP rimangono il parente povero in letteratura di fronte all...

Jarris, P.E., 2016: Population health: no one does it alone. Journal of Public Health Management and Practice 20(5): 554-556

Remahl, I.Nilsson.; Fredrikson, S.; Gunnarsson, M.; Hietala, A.; Stridh, L.; Jood, K.; Burman, J.; Johansson, R.; Jensen, S.Marup.; Petersson, J.; Zarrinkobb, L.; Smits, A., 2012: The Swedish Neurological Association: The number of neurologists need to double over the next decade. Lakartidningen 109(19): 970-970

Kilpatrick, M.W.; Walker, R.T., 1980: The nucleotide sequence of glycine tRNA from Mycoplasma mycoides sp. capri. Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly h...

Cordy, JM., 1980: Lagurus lagurus (Pallas, 1773) (Rodentia, Mammalia) dans le quaternaire de Belgique. Several of the mandibles preserved in the famous Schmerling collection, belong to the grey lemming, L. lagurus. These fossils were obtained from a cave in the Liege area and probably correspond to a single horizon. The grey lemming, presently know...

Hartenstein, H.-Ulrich; Horvay, M., 1996: Overview of municipal waste incineration industry in west Europe (base on the German experience). This paper presents an overview of the current status of the waste-to-energy activities in the west European countries, outlining the demand for municipal waste incineration and the development in the design of the combustion system as well as in...

Ramirez Bosca A.; Martinez Ojeda L.; Valcuende Cavero F.; Castells Rodellas A., 1988: A study of local immunity in psoriasis. We have studied biopsies of lesional skin monoclonal and polyclonal antibodies to determine the nature of the infiltrate forms of psoriasis. In guttate psoriasis the number of Langerhans cells (LC) was not increased and CD8+ cells predominated, ho...

Breslow R.; Berger D.; Huang D L.; Light J.; Thiem H., 1990: Bifunctional hydrolytic enzyme mimics based on metals. Journal of Cellular Biochemistry Supplement (14 PART C): 192

Prodromou C.; Artymiuk P.J.; Guest J.R., 1992: The aconitase of escherichia coli nucleotide sequence of the aconitase gene and amino acid sequence similarity with mitochondrial aconitases the iron responsive element binding protein and isopropylmalate isomerases. The nucleotide sequence of the aconitase gene (acn) of Escherichia coli was determined and used to deduce the primary structure of the enzyme. The coding region comprises 2670 bp (890 codons excluding the start and stop codons) which define a prod...

Shibata, Y.; Kuraoka, A.; Hatae, T.; IIda, H., 1993: Deep etching study of gap junctions. Anatomical Record 0(SUPPL 1): 104