geoscience.net logo
+ Resolve Article
+ Follow Us
Follow on FacebookFollow on Facebook
Follow on TwitterFollow on Twitter

+ Translate
+ Subscribe to Site Feed
GeoScience Most Shared ContentMost Shared Content

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only


, : A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only. Bioscience Reports 1(3): 235-241

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms, respectively, in tomato exhibited defined differences in the RNase T1 and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the 'severe' strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.

US$29.90

PMID: 6271277


Other references

Lächelt, U.; Kos, P.; Mickler, F.M.; Herrmann, A.; Salcher, E.E.; Rödl, W.; Badgujar, N.; Bräuchle, C.; Wagner, E., 2014: Fine-tuning of proton sponges by precise diaminoethanes and histidines in pDNA polyplexes. The cationizable nature of 'proton-sponge' transfection agents facilitates pDNA delivery in several steps. Protonated amines account for electrostatic DNA binding and cellular uptake, buffering amines mediate polyplex escape from acidify...

Ford, S.P.; Reynolds, L.P.; Magness, R.R., 1982: Blood flow to the uterine and ovarian vascular beds of gilts during the estrous cycle or early pregnancy. Blood flow to uteri, ovaries and other selected maternal tissues of 3 nonpregnant (NP) and 4 pregnant (P) gilts was determined on days 9, 11, 13 and 15 postestrus or postmating (day 0 = 1st day of estrus or mating) using .gamma.-labeled microspher...

Steinfurth, E.C.K.; Kanen, J.W.; Raio, C.M.; Clem, R.L.; Huganir, R.L.; Phelps, E.A., 2015: Young and old Pavlovian fear memories can be modified with extinction training during reconsolidation in humans. Extinction training during reconsolidation has been shown to persistently diminish conditioned fear responses across species. We investigated in humans if older fear memories can benefit similarly. Using a Pavlovian fear conditioning paradigm we c...

Wang, S.; Zheng Changlin; Kobayashi, T., 1989: A tentative list of threatened rodents in China and Japan with notes on their distribution, habitat, and status. Occasional Papers of the IUCN Species Survival Commission, Suppl. No. 4: 42-44

Quilligan E.J., 1975: Intra partum intensive care. Adamsons, Karlis And Howard A Fox (Ed ) Progress in Clinical And Biological Research, Vol 2 Preventability Of Perinatal Injury Proceedings Of A Symposium New York, N Y , U S A , March, X+229p Illus Alan R Liss, Inc : New York, N Y , U S A Isbn 0-8451-0025-4 117-122

Levin, G.; Saleh, N.A.; Haj-Yahya, R.; Matan, L.S.; Benshushan, A., 2017: Predicting success of methotrexate treatment by pretreatment HCG level and 24-hour HCG increment. To evaluate β-human chorionic gonadotropin (β-HCG) level and its 24-hour increment as predictors of successful methotrexate treatment for ectopic pregnancy. Data were retrospectively reviewed from women with ectopic pregnancy who were treated by...

Chiang S.C., 1968: Refraction shooting at the site projected for the nuclear power plant in Linkou, Taipei, Taiwan. Petroleum Geology of Taiwan 6: 263-283

May, R.M.; Denefle, J.P.; Heurtault-Rossi, J., 1966: Conditioning by colchicine of interracial brephoplastic grafts of thyroid glands in rabbits. Comptes Rendus des Seances de la Societe de Biologie et de Ses Filiales 160(11): 2025-2027

Cai, W.; Bulatov, V.V.; Chang, J.; Li, J.; Yip, S., 2001: Anisotropic elastic interactions of a periodic dislocation array. A method for calculating the anisotropic elastic energy of a dislocation dipole in a periodic cell is derived in which the infinite image summation is absolutely convergent. The core energy of a screw dislocation in Si, extracted from atomistic si...

Vrieling, K.S.umitou-Laprade, P.C.guen, J.D.jk, H.V.n; Jong, T.-De; Klinkhamer, P., 1999: Direct and indirect estimates of the selfing rate in small and large individuals of the bumblebee pollinated Cynoglossum officinale L (Boraginaceae). We measured the relationship between selfing rates and flower number in an experimental population of bumblebee pollinated Cynoglossum officinale, with plants differing in flower number. Results were compared with the prediction of a model based o...